Japanese
 NBRP Rat No: 0908 Strain NameLE-Tg(Pdyn-cre)2-9Koba Commmon Name: Pdyn_Cre RecBAC 2-9ラット
 Principal Investigator  Kazuto Kobayashi
 Organization   Fukushima Medical University Department of Biomolecular Science, Institute of Biomedical Sciences
 Address  1 Hikarigaoka Fukushima-shi

960-1295 Fukushima

 Japan
 Telephone  024-547-1667  Fax:  024-548-3936  kazuto@fmu.ac.jp
 Inbred Generations   F9 (April 2019) 
   
 Coat Color
 Deposition Status
 
 白黒
  Embryo      Sperm      Live Animals
 Usage Restrictions  The following specific terms and conditions are requested by the DEPOSITOR. In this event, the RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
Tha RECIPIENT requires a collabration with the DEPOSITOR. Consult with the DEPOSITOR about details beforehand. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene cre: cre recombinase protein, Pdyn: preprodynorphin
 Origin Background strain: Long-Evans (Iar:Long-Evans, Institute for Animal Reproduction)
This strain was produced by injecting a modified BAC, in which a Cre recombinase was inserted into the third exon of the rat Pdyn gene, into rat zygotes. 
 Strain Characteristics This strain is a transgenic rat that expresses Cre recombinase under the control of the Pdyn gene. 
 Breeding Conditions Breeding performance is good.
Maintain heterozygous rats by mating them with Long Evans (LE) rats. 
 Genotyping The PCR method is used to detect Cre recombinase.
Primer
F: TCGATGCAACGAGTGATGAG, R: TTCGGCTATACGTAACAGGG
PCR conditions
TaKaRa Taq 94℃ 5min→94℃(30cycle) 20sec→56℃ 30sec→72℃ 30sec→4℃ ∞ 482bp 
 References  投稿中
Submitted for publication.