Japanese
 NBRP Rat No: 0975 Strain Name: W-Gpr143em19Gosh Commmon Name: Gpr143 KO
 Principal Investigator  Yoshio Goshima
 Organization   Yokohama City University Department of Molecular Pharmacology and Neurobiology, Graduate School of Medicine
 Address  3-9 Fukuura, Kanazawa-ku, Yokohama, Kanagawa

236-0004 Kanagawa

  Japan
 Telephone  045-787-2595  Fax:  045-785-3645  goshima@yokohama-cu.ac.jp
 Inbred Generations    
   
 Coat Color
 Deposition Status
 
 白色
  Embryo      Sperm      Live Animals
 Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Right ventricular overloading is attenuated in monocrotaline-induced pulmonary hypertension model rats with a disrupted Gpr143 gene, the gene that encodes the 3,4-l-dihydroxyphenyalanine(l-DOPA) receptor.
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
For the first two years after deposit, the RECIPIENT requires a collaboration with the DEPOSITOR. Consult with the DEPOSITOR about details boforehand.
The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial uses based
on the results from the use of the BIOLOGICAL RSOURCE. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene Rattus norvegicus G protein-coupled receptor 143 (Gpr143)
 Origin Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. 
 Strain Characteristics  
 Breeding Conditions Maintained by natural mating. 
 Genotyping Primers: Forward: gaggtaaggaaggcctggtggatggag Reverse: ctgctctgcacccaagggtcactcac
PCR conditions: 95°C 2min, 95°C 30s, 58°C 30s, 72°C 1min, 30 cycles
WT 657 bp, KO 413 bp 
 References  Nakano et al., Right ventricular overloading is attenuated in monocrotaline-induced pulmonary hypertension model rats with a disrupted Gpr143 gene, the gene that encodes the 3,4-L-dihydroxyphenyalanine (L-DOPA) receptor., J Pharmacol Sci., 2021